2-well chamber slides with glass coverslip bottoms (Thermo Fisher)
Thermo Fisher is a verified supplier 
Thermo Fisher manufactures this product 
90
Structured Review
Thermo Fisher
2-well chamber slides with glass coverslip bottoms
2 Well Chamber Slides With Glass Coverslip Bottoms, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/2-well+chamber+slide/2+well+chamber+slides+with+glass+coverslip+bottoms/pmc11228511__pnas__2406946121__sapp-55-14-17
Average 90 stars, based on 1 article reviews
2 Well Chamber Slides With Glass Coverslip Bottoms, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/2-well+chamber+slide/2+well+chamber+slides+with+glass+coverslip+bottoms/pmc11228511__pnas__2406946121__sapp-55-14-17
Average 90 stars, based on 1 article reviews
2-well chamber slides with glass coverslip bottoms - by Bioz Stars,
2026-09
90/100 stars
Images
Related Articles
Infection:Article Title: Male meiotic spindle poles are stabilized by TACC3 and cKAP5/chTOG differently from female meiotic or somatic mitotic spindles in mice. Article Snippet: Tubules were then further cut into 1.5- to 3-mm pieces with scissors in 100 μl of Article Title: Erythropoietin receptor signal is crucial for periodontal ligament stem cell-based tissue reconstruction in periodontal disease Article Snippet: For BrdU incorporation assay, PDLSCs (1 × 10 3 ), including Cont-PDLSCs, PD-PDLSCs, MOCK-PD-PDLSCs, EPO-PD-PDLSCs, siCONT-PDLSCs, and siEPOR-PDLSCs, were cultured on a 2-well chamber slide (Thermo Fisher Scientific) in CGM for 2 days and examined by using a Article Title: Erythropoietin receptor signal is crucial for periodontal ligament stem cell-based tissue reconstruction in periodontal disease. Article Snippet: BrdU incorporation assay of PDLSCs For BrdU incorporation assay, PDLSCs (1 × 103), including Cont-PDLSCs, PD-PDLSCs, MOCK-PD-PDLSCs, EPO-PD-PDLSCs, siCONT-PDLSCs, and siEPOR-PDLSCs, were cultured on a 2-well chamber slide (Thermo Fisher Scientific) in CGM for 2 days and examined by using a Article Title: Bipolar electrochemical sensor with perylene diimide-based cathodic luminophore for dopamine detection and imaging. Article Snippet: A Article Title: Magnetoelastic Monitoring System for Tracking Growth of Human Mesenchymal Stromal Cells. Article Snippet: Next, a single sensor was placed in the rear well (Figure 6) of a Article Title: Development of pial collaterals by extension of pre-existing artery tips. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Cxcr4 flox Forward primer (5’ / 3’) CCACCCAGGACAGTGTGACTCTAA The Jackson Laboratory N/A Cxcr4 flox Reverse primer (5’ / 3’) GATGGGATTTCTGTATGAGGATTAGC The Jackson Laboratory N/A Dach1 flox Forward primer (5’ / 3’) CTCCTGAAGATGAGGAGCTCACCCC Chang et al.19 N/A Dach1 flox Reverse primer (5’ / 3’) AACAATTCTTGTCCTTCACGTGCCC Chang et al.19 N/A Software and algorithms ImageJ NIH (https://imagej.nih.gov/ij/) RRID:SCR_003070 GraphPad Prism 9 GraphPad Software (http://www.graphpad.com/ scientific-software/prism/) RRID:SCR_002798 Adobe Photoshop Adobe (https://www.adobe.com/ products/photoshop.html) RRID:SCR_014199 Adobe Illustrator Adobe (https://www.adobe.com/ products/photoshop.html) RRID:SCR_010279 OriginPro 2024b OriginLab (https://www.originlab.com/ index.aspx?go=PRODUCTS/Origin) RRID:SCR_014212 Other Anti-fade mounting media Jackson ImmunoResearch Laboratories Inc N/A Dental cement 3M Relyx U200 Catalog# 56877 Norland Optical Adhesive 68 Norland Products Catalog# NOA 81, Article Title: Crosstalk in Skin: Loss of Desmoglein 1 in Keratinocytes Inhibits BRAF V600E -induced Cellular Senescence in Human Melanocytes. Article Snippet: Melanocytes were plated into Article Title: Crosstalk in skin: Loss of desmoglein 1 in keratinocytes inhibits BRAF V600E -induced cellular senescence in human melanocytes Article Snippet: Melanocytes were plated into Transduction:Article Title: Male meiotic spindle poles are stabilized by TACC3 and cKAP5/chTOG differently from female meiotic or somatic mitotic spindles in mice. Article Snippet: Tubules were then further cut into 1.5- to 3-mm pieces with scissors in 100 μl of Article Title: Erythropoietin receptor signal is crucial for periodontal ligament stem cell-based tissue reconstruction in periodontal disease Article Snippet: For BrdU incorporation assay, PDLSCs (1 × 10 3 ), including Cont-PDLSCs, PD-PDLSCs, MOCK-PD-PDLSCs, EPO-PD-PDLSCs, siCONT-PDLSCs, and siEPOR-PDLSCs, were cultured on a 2-well chamber slide (Thermo Fisher Scientific) in CGM for 2 days and examined by using a Article Title: Erythropoietin receptor signal is crucial for periodontal ligament stem cell-based tissue reconstruction in periodontal disease. Article Snippet: BrdU incorporation assay of PDLSCs For BrdU incorporation assay, PDLSCs (1 × 103), including Cont-PDLSCs, PD-PDLSCs, MOCK-PD-PDLSCs, EPO-PD-PDLSCs, siCONT-PDLSCs, and siEPOR-PDLSCs, were cultured on a 2-well chamber slide (Thermo Fisher Scientific) in CGM for 2 days and examined by using a Article Title: Bipolar electrochemical sensor with perylene diimide-based cathodic luminophore for dopamine detection and imaging. Article Snippet: A Article Title: Magnetoelastic Monitoring System for Tracking Growth of Human Mesenchymal Stromal Cells. Article Snippet: Next, a single sensor was placed in the rear well (Figure 6) of a Article Title: Development of pial collaterals by extension of pre-existing artery tips. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Cxcr4 flox Forward primer (5’ / 3’) CCACCCAGGACAGTGTGACTCTAA The Jackson Laboratory N/A Cxcr4 flox Reverse primer (5’ / 3’) GATGGGATTTCTGTATGAGGATTAGC The Jackson Laboratory N/A Dach1 flox Forward primer (5’ / 3’) CTCCTGAAGATGAGGAGCTCACCCC Chang et al.19 N/A Dach1 flox Reverse primer (5’ / 3’) AACAATTCTTGTCCTTCACGTGCCC Chang et al.19 N/A Software and algorithms ImageJ NIH (https://imagej.nih.gov/ij/) RRID:SCR_003070 GraphPad Prism 9 GraphPad Software (http://www.graphpad.com/ scientific-software/prism/) RRID:SCR_002798 Adobe Photoshop Adobe (https://www.adobe.com/ products/photoshop.html) RRID:SCR_014199 Adobe Illustrator Adobe (https://www.adobe.com/ products/photoshop.html) RRID:SCR_010279 OriginPro 2024b OriginLab (https://www.originlab.com/ index.aspx?go=PRODUCTS/Origin) RRID:SCR_014212 Other Anti-fade mounting media Jackson ImmunoResearch Laboratories Inc N/A Dental cement 3M Relyx U200 Catalog# 56877 Norland Optical Adhesive 68 Norland Products Catalog# NOA 81, Article Title: Crosstalk in Skin: Loss of Desmoglein 1 in Keratinocytes Inhibits BRAF V600E -induced Cellular Senescence in Human Melanocytes. Article Snippet: Melanocytes were plated into Article Title: Crosstalk in skin: Loss of desmoglein 1 in keratinocytes inhibits BRAF V600E -induced cellular senescence in human melanocytes Article Snippet: Melanocytes were plated into Software:Article Title: Male meiotic spindle poles are stabilized by TACC3 and cKAP5/chTOG differently from female meiotic or somatic mitotic spindles in mice. Article Snippet: Tubules were then further cut into 1.5- to 3-mm pieces with scissors in 100 μl of Article Title: Erythropoietin receptor signal is crucial for periodontal ligament stem cell-based tissue reconstruction in periodontal disease Article Snippet: For BrdU incorporation assay, PDLSCs (1 × 10 3 ), including Cont-PDLSCs, PD-PDLSCs, MOCK-PD-PDLSCs, EPO-PD-PDLSCs, siCONT-PDLSCs, and siEPOR-PDLSCs, were cultured on a 2-well chamber slide (Thermo Fisher Scientific) in CGM for 2 days and examined by using a Article Title: Erythropoietin receptor signal is crucial for periodontal ligament stem cell-based tissue reconstruction in periodontal disease. Article Snippet: BrdU incorporation assay of PDLSCs For BrdU incorporation assay, PDLSCs (1 × 103), including Cont-PDLSCs, PD-PDLSCs, MOCK-PD-PDLSCs, EPO-PD-PDLSCs, siCONT-PDLSCs, and siEPOR-PDLSCs, were cultured on a 2-well chamber slide (Thermo Fisher Scientific) in CGM for 2 days and examined by using a Article Title: Bipolar electrochemical sensor with perylene diimide-based cathodic luminophore for dopamine detection and imaging. Article Snippet: A Article Title: Magnetoelastic Monitoring System for Tracking Growth of Human Mesenchymal Stromal Cells. Article Snippet: Next, a single sensor was placed in the rear well (Figure 6) of a Article Title: Development of pial collaterals by extension of pre-existing artery tips. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Cxcr4 flox Forward primer (5’ / 3’) CCACCCAGGACAGTGTGACTCTAA The Jackson Laboratory N/A Cxcr4 flox Reverse primer (5’ / 3’) GATGGGATTTCTGTATGAGGATTAGC The Jackson Laboratory N/A Dach1 flox Forward primer (5’ / 3’) CTCCTGAAGATGAGGAGCTCACCCC Chang et al.19 N/A Dach1 flox Reverse primer (5’ / 3’) AACAATTCTTGTCCTTCACGTGCCC Chang et al.19 N/A Software and algorithms ImageJ NIH (https://imagej.nih.gov/ij/) RRID:SCR_003070 GraphPad Prism 9 GraphPad Software (http://www.graphpad.com/ scientific-software/prism/) RRID:SCR_002798 Adobe Photoshop Adobe (https://www.adobe.com/ products/photoshop.html) RRID:SCR_014199 Adobe Illustrator Adobe (https://www.adobe.com/ products/photoshop.html) RRID:SCR_010279 OriginPro 2024b OriginLab (https://www.originlab.com/ index.aspx?go=PRODUCTS/Origin) RRID:SCR_014212 Other Anti-fade mounting media Jackson ImmunoResearch Laboratories Inc N/A Dental cement 3M Relyx U200 Catalog# 56877 Norland Optical Adhesive 68 Norland Products Catalog# NOA 81, Article Title: Crosstalk in Skin: Loss of Desmoglein 1 in Keratinocytes Inhibits BRAF V600E -induced Cellular Senescence in Human Melanocytes. Article Snippet: Melanocytes were plated into Article Title: Crosstalk in skin: Loss of desmoglein 1 in keratinocytes inhibits BRAF V600E -induced cellular senescence in human melanocytes Article Snippet: Melanocytes were plated into Adhesive:Article Title: Male meiotic spindle poles are stabilized by TACC3 and cKAP5/chTOG differently from female meiotic or somatic mitotic spindles in mice. Article Snippet: Tubules were then further cut into 1.5- to 3-mm pieces with scissors in 100 μl of Article Title: Erythropoietin receptor signal is crucial for periodontal ligament stem cell-based tissue reconstruction in periodontal disease Article Snippet: For BrdU incorporation assay, PDLSCs (1 × 10 3 ), including Cont-PDLSCs, PD-PDLSCs, MOCK-PD-PDLSCs, EPO-PD-PDLSCs, siCONT-PDLSCs, and siEPOR-PDLSCs, were cultured on a 2-well chamber slide (Thermo Fisher Scientific) in CGM for 2 days and examined by using a Article Title: Erythropoietin receptor signal is crucial for periodontal ligament stem cell-based tissue reconstruction in periodontal disease. Article Snippet: BrdU incorporation assay of PDLSCs For BrdU incorporation assay, PDLSCs (1 × 103), including Cont-PDLSCs, PD-PDLSCs, MOCK-PD-PDLSCs, EPO-PD-PDLSCs, siCONT-PDLSCs, and siEPOR-PDLSCs, were cultured on a 2-well chamber slide (Thermo Fisher Scientific) in CGM for 2 days and examined by using a Article Title: Bipolar electrochemical sensor with perylene diimide-based cathodic luminophore for dopamine detection and imaging. Article Snippet: A Article Title: Magnetoelastic Monitoring System for Tracking Growth of Human Mesenchymal Stromal Cells. Article Snippet: Next, a single sensor was placed in the rear well (Figure 6) of a Article Title: Development of pial collaterals by extension of pre-existing artery tips. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Cxcr4 flox Forward primer (5’ / 3’) CCACCCAGGACAGTGTGACTCTAA The Jackson Laboratory N/A Cxcr4 flox Reverse primer (5’ / 3’) GATGGGATTTCTGTATGAGGATTAGC The Jackson Laboratory N/A Dach1 flox Forward primer (5’ / 3’) CTCCTGAAGATGAGGAGCTCACCCC Chang et al.19 N/A Dach1 flox Reverse primer (5’ / 3’) AACAATTCTTGTCCTTCACGTGCCC Chang et al.19 N/A Software and algorithms ImageJ NIH (https://imagej.nih.gov/ij/) RRID:SCR_003070 GraphPad Prism 9 GraphPad Software (http://www.graphpad.com/ scientific-software/prism/) RRID:SCR_002798 Adobe Photoshop Adobe (https://www.adobe.com/ products/photoshop.html) RRID:SCR_014199 Adobe Illustrator Adobe (https://www.adobe.com/ products/photoshop.html) RRID:SCR_010279 OriginPro 2024b OriginLab (https://www.originlab.com/ index.aspx?go=PRODUCTS/Origin) RRID:SCR_014212 Other Anti-fade mounting media Jackson ImmunoResearch Laboratories Inc N/A Dental cement 3M Relyx U200 Catalog# 56877 Norland Optical Adhesive 68 Norland Products Catalog# NOA 81, Article Title: Crosstalk in Skin: Loss of Desmoglein 1 in Keratinocytes Inhibits BRAF V600E -induced Cellular Senescence in Human Melanocytes. Article Snippet: Melanocytes were plated into Article Title: Crosstalk in skin: Loss of desmoglein 1 in keratinocytes inhibits BRAF V600E -induced cellular senescence in human melanocytes Article Snippet: Melanocytes were plated into BrdU Incorporation Assay:Article Title: Male meiotic spindle poles are stabilized by TACC3 and cKAP5/chTOG differently from female meiotic or somatic mitotic spindles in mice. Article Snippet: Tubules were then further cut into 1.5- to 3-mm pieces with scissors in 100 μl of Article Title: Erythropoietin receptor signal is crucial for periodontal ligament stem cell-based tissue reconstruction in periodontal disease Article Snippet: For BrdU incorporation assay, PDLSCs (1 × 10 3 ), including Cont-PDLSCs, PD-PDLSCs, MOCK-PD-PDLSCs, EPO-PD-PDLSCs, siCONT-PDLSCs, and siEPOR-PDLSCs, were cultured on a 2-well chamber slide (Thermo Fisher Scientific) in CGM for 2 days and examined by using a Article Title: Erythropoietin receptor signal is crucial for periodontal ligament stem cell-based tissue reconstruction in periodontal disease. Article Snippet: BrdU incorporation assay of PDLSCs For BrdU incorporation assay, PDLSCs (1 × 103), including Cont-PDLSCs, PD-PDLSCs, MOCK-PD-PDLSCs, EPO-PD-PDLSCs, siCONT-PDLSCs, and siEPOR-PDLSCs, were cultured on a 2-well chamber slide (Thermo Fisher Scientific) in CGM for 2 days and examined by using a Article Title: Bipolar electrochemical sensor with perylene diimide-based cathodic luminophore for dopamine detection and imaging. Article Snippet: A Article Title: Magnetoelastic Monitoring System for Tracking Growth of Human Mesenchymal Stromal Cells. Article Snippet: Next, a single sensor was placed in the rear well (Figure 6) of a Article Title: Development of pial collaterals by extension of pre-existing artery tips. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Cxcr4 flox Forward primer (5’ / 3’) CCACCCAGGACAGTGTGACTCTAA The Jackson Laboratory N/A Cxcr4 flox Reverse primer (5’ / 3’) GATGGGATTTCTGTATGAGGATTAGC The Jackson Laboratory N/A Dach1 flox Forward primer (5’ / 3’) CTCCTGAAGATGAGGAGCTCACCCC Chang et al.19 N/A Dach1 flox Reverse primer (5’ / 3’) AACAATTCTTGTCCTTCACGTGCCC Chang et al.19 N/A Software and algorithms ImageJ NIH (https://imagej.nih.gov/ij/) RRID:SCR_003070 GraphPad Prism 9 GraphPad Software (http://www.graphpad.com/ scientific-software/prism/) RRID:SCR_002798 Adobe Photoshop Adobe (https://www.adobe.com/ products/photoshop.html) RRID:SCR_014199 Adobe Illustrator Adobe (https://www.adobe.com/ products/photoshop.html) RRID:SCR_010279 OriginPro 2024b OriginLab (https://www.originlab.com/ index.aspx?go=PRODUCTS/Origin) RRID:SCR_014212 Other Anti-fade mounting media Jackson ImmunoResearch Laboratories Inc N/A Dental cement 3M Relyx U200 Catalog# 56877 Norland Optical Adhesive 68 Norland Products Catalog# NOA 81, Article Title: Crosstalk in Skin: Loss of Desmoglein 1 in Keratinocytes Inhibits BRAF V600E -induced Cellular Senescence in Human Melanocytes. Article Snippet: Melanocytes were plated into Article Title: Crosstalk in skin: Loss of desmoglein 1 in keratinocytes inhibits BRAF V600E -induced cellular senescence in human melanocytes Article Snippet: Melanocytes were plated into Cell Culture:Article Title: Male meiotic spindle poles are stabilized by TACC3 and cKAP5/chTOG differently from female meiotic or somatic mitotic spindles in mice. Article Snippet: Tubules were then further cut into 1.5- to 3-mm pieces with scissors in 100 μl of Article Title: Erythropoietin receptor signal is crucial for periodontal ligament stem cell-based tissue reconstruction in periodontal disease Article Snippet: For BrdU incorporation assay, PDLSCs (1 × 10 3 ), including Cont-PDLSCs, PD-PDLSCs, MOCK-PD-PDLSCs, EPO-PD-PDLSCs, siCONT-PDLSCs, and siEPOR-PDLSCs, were cultured on a 2-well chamber slide (Thermo Fisher Scientific) in CGM for 2 days and examined by using a Article Title: Erythropoietin receptor signal is crucial for periodontal ligament stem cell-based tissue reconstruction in periodontal disease. Article Snippet: BrdU incorporation assay of PDLSCs For BrdU incorporation assay, PDLSCs (1 × 103), including Cont-PDLSCs, PD-PDLSCs, MOCK-PD-PDLSCs, EPO-PD-PDLSCs, siCONT-PDLSCs, and siEPOR-PDLSCs, were cultured on a 2-well chamber slide (Thermo Fisher Scientific) in CGM for 2 days and examined by using a Article Title: Bipolar electrochemical sensor with perylene diimide-based cathodic luminophore for dopamine detection and imaging. Article Snippet: A Article Title: Magnetoelastic Monitoring System for Tracking Growth of Human Mesenchymal Stromal Cells. Article Snippet: Next, a single sensor was placed in the rear well (Figure 6) of a Article Title: Development of pial collaterals by extension of pre-existing artery tips. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Cxcr4 flox Forward primer (5’ / 3’) CCACCCAGGACAGTGTGACTCTAA The Jackson Laboratory N/A Cxcr4 flox Reverse primer (5’ / 3’) GATGGGATTTCTGTATGAGGATTAGC The Jackson Laboratory N/A Dach1 flox Forward primer (5’ / 3’) CTCCTGAAGATGAGGAGCTCACCCC Chang et al.19 N/A Dach1 flox Reverse primer (5’ / 3’) AACAATTCTTGTCCTTCACGTGCCC Chang et al.19 N/A Software and algorithms ImageJ NIH (https://imagej.nih.gov/ij/) RRID:SCR_003070 GraphPad Prism 9 GraphPad Software (http://www.graphpad.com/ scientific-software/prism/) RRID:SCR_002798 Adobe Photoshop Adobe (https://www.adobe.com/ products/photoshop.html) RRID:SCR_014199 Adobe Illustrator Adobe (https://www.adobe.com/ products/photoshop.html) RRID:SCR_010279 OriginPro 2024b OriginLab (https://www.originlab.com/ index.aspx?go=PRODUCTS/Origin) RRID:SCR_014212 Other Anti-fade mounting media Jackson ImmunoResearch Laboratories Inc N/A Dental cement 3M Relyx U200 Catalog# 56877 Norland Optical Adhesive 68 Norland Products Catalog# NOA 81, Article Title: Crosstalk in Skin: Loss of Desmoglein 1 in Keratinocytes Inhibits BRAF V600E -induced Cellular Senescence in Human Melanocytes. Article Snippet: Melanocytes were plated into Article Title: Crosstalk in skin: Loss of desmoglein 1 in keratinocytes inhibits BRAF V600E -induced cellular senescence in human melanocytes Article Snippet: Melanocytes were plated into BrdU Staining:Article Title: Male meiotic spindle poles are stabilized by TACC3 and cKAP5/chTOG differently from female meiotic or somatic mitotic spindles in mice. Article Snippet: Tubules were then further cut into 1.5- to 3-mm pieces with scissors in 100 μl of Article Title: Erythropoietin receptor signal is crucial for periodontal ligament stem cell-based tissue reconstruction in periodontal disease Article Snippet: For BrdU incorporation assay, PDLSCs (1 × 10 3 ), including Cont-PDLSCs, PD-PDLSCs, MOCK-PD-PDLSCs, EPO-PD-PDLSCs, siCONT-PDLSCs, and siEPOR-PDLSCs, were cultured on a 2-well chamber slide (Thermo Fisher Scientific) in CGM for 2 days and examined by using a Article Title: Erythropoietin receptor signal is crucial for periodontal ligament stem cell-based tissue reconstruction in periodontal disease. Article Snippet: BrdU incorporation assay of PDLSCs For BrdU incorporation assay, PDLSCs (1 × 103), including Cont-PDLSCs, PD-PDLSCs, MOCK-PD-PDLSCs, EPO-PD-PDLSCs, siCONT-PDLSCs, and siEPOR-PDLSCs, were cultured on a 2-well chamber slide (Thermo Fisher Scientific) in CGM for 2 days and examined by using a Article Title: Bipolar electrochemical sensor with perylene diimide-based cathodic luminophore for dopamine detection and imaging. Article Snippet: A Article Title: Magnetoelastic Monitoring System for Tracking Growth of Human Mesenchymal Stromal Cells. Article Snippet: Next, a single sensor was placed in the rear well (Figure 6) of a Article Title: Development of pial collaterals by extension of pre-existing artery tips. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Cxcr4 flox Forward primer (5’ / 3’) CCACCCAGGACAGTGTGACTCTAA The Jackson Laboratory N/A Cxcr4 flox Reverse primer (5’ / 3’) GATGGGATTTCTGTATGAGGATTAGC The Jackson Laboratory N/A Dach1 flox Forward primer (5’ / 3’) CTCCTGAAGATGAGGAGCTCACCCC Chang et al.19 N/A Dach1 flox Reverse primer (5’ / 3’) AACAATTCTTGTCCTTCACGTGCCC Chang et al.19 N/A Software and algorithms ImageJ NIH (https://imagej.nih.gov/ij/) RRID:SCR_003070 GraphPad Prism 9 GraphPad Software (http://www.graphpad.com/ scientific-software/prism/) RRID:SCR_002798 Adobe Photoshop Adobe (https://www.adobe.com/ products/photoshop.html) RRID:SCR_014199 Adobe Illustrator Adobe (https://www.adobe.com/ products/photoshop.html) RRID:SCR_010279 OriginPro 2024b OriginLab (https://www.originlab.com/ index.aspx?go=PRODUCTS/Origin) RRID:SCR_014212 Other Anti-fade mounting media Jackson ImmunoResearch Laboratories Inc N/A Dental cement 3M Relyx U200 Catalog# 56877 Norland Optical Adhesive 68 Norland Products Catalog# NOA 81, Article Title: Crosstalk in Skin: Loss of Desmoglein 1 in Keratinocytes Inhibits BRAF V600E -induced Cellular Senescence in Human Melanocytes. Article Snippet: Melanocytes were plated into Article Title: Crosstalk in skin: Loss of desmoglein 1 in keratinocytes inhibits BRAF V600E -induced cellular senescence in human melanocytes Article Snippet: Melanocytes were plated into |